Fig. 4
From: Infection of primary hepatocytes with adenoviral vectors alters biliary lipid metabolism
Effect of adenoviral infection on the mRNA expression levels of genes relevant in hepatocyte bile salt metabolism. Total RNA was extracted from cells 24 h after infection and reverse transcribed, and quantitative PCRs were performed. Results were normalized with data from three control genes (GAPDH, A cyclophilin and 18S rRNA), using geNorm. GenBank accession numbers of sequences used for designing primers for PCRs and forward (f) and reverse (r) primers: Bsep (NM_031760), f: gccattgtgcgagatcctaaa, r: tgcaggtccgaccctctct; Cyp 7a1 (NM_012942), f: attgccgtgttggtgagctg, r: gaatcaacccgttctccaaagg; FXR (U18374), f: gtgacaaagaagccgcgaat, r: gcaggtgagcgcgttgtaat; SHP (D86580), f: ctcggtttgcatacagtgtttga, r: gcatattggcctggaggtttt; LRH-1 (NM_021742), f: tggtgagactccgttccctt, r: tggacgccttccaccag; GAPDH (NM_017008), f: gtgccagcctcgtctgatagac. r: aaggcagccctggtaaccag; A cyclophilin (NM_017101), f: ccaagactgagtggctggatg, r: gctccatggcttccacaatg; 18S rRNA (X01117), f: ttcgaacgtctgccctatcaac, r: gaaccctgattccccgtcac. a mRNA levels in AdSS- and AdAS-infected cultures, referred to control cells. Data represent the mean ± SE of nine samples from three different preparations. ANOVA analysis: # P < 0.05, ## P < 0.01. Bonferroni’s test: **P < 0.01 compared with control cells. b Data from infected cells were merged and compared with those from control cells to assess the effect of infection itself. Student’s t test: *P < 0.05 and **P < 0.01 compared with control cells