Skip to main content

Table 1 Real-time reverse transcriptional (RT)-PCR primer sequences

From: Effect of Myostatin SNP on muscle fiber properties in male Thoroughbred horses during training period

  Forward sequence Reverse sequence
GAPDH CAAGGCTGTGGGCAAGGT GGAAGGCCATGCCAGTGA
Myostatin TGACAGCAGTGATGGCTCTT TTGGGTTTTCCTTCCACTTG
Pax7 CATCGGCGGCAGCAA TCCTCGATCTTTTTCTCCACATC
MyoD ACGGCTCTCTCTGCAACTTTG GAGTCGAAACACGGGTCATCA
myogenin TCACGGCTGACCCTACAGATG GGTGATGCTGTCCACAATGG
SDHa AGGTTTGCTGATGGCAGTATAAGA TGCATCGACTTCTGCATGCT
VEGFa CCCACTGCGGAGTTCAACAT TTGGCTTTGGTGAGGTTTGAT
PGC1α TCCGTGTCACCACCCAAAT TGAACGAGAGCGCATCCTT
HGF GGTACGCTACGAAGTCTGTGACA CCCATTGCAGGTCATGCAT
MHC1 GGAATGACAACTCCTCTCGCTTT TCAATATCAGCAGAAGCCAGTTTC
MHC2 CCCATGAACCCTCCCAAATA GCAGGCTCATGCAGGTGAGT
  1. GAPDH glyceraldehydes-3-phosphate dehydrogenase, Pax7 paired box transcription factor-7, MyoD myogenic determination factor, SDHa succinate dehydrogenase subunit a, VEGFa vascular endothelial growth factor-A, PGC1α peroxisome proliferator-activated receptor γ coactivator-1α, HGF hepatocyte growth factor, MHC Myosin heavy chain