Skip to main content

Table 1 PCR primers for the real time PCR

From: β-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and SHR-mtBN conplastic rat strains: the effect of chronic hypoxia

Gene Forward primer Reverse primer
AC5 gggagaaccagcaacagg catctccatggcaacatgac
AC6 atgagatcatcgcggacttt gccatgtaagtgctaccgatg
ACO1 ttgctgtgtctgagattgaaaag cttgaaaacctttaaatccttgct
ACO2 cgccttacagcctactggtc ggcagaggccacatggta
ALDH2 agacgtcaaagatggcatga ttgaggatctgcatcactgg
CAT cagcgaccagatgaagca ggtcaggacatcgggtttc
CuZnSOD taagaaacatggcggtcca tggacacattggccacac
GSTO1 aagcttgccagaagatgacc ctcttcgccctaataaaactcg
MAOA tggtatcatgacccagtatgga tgtgcctgcaaagtaaatcct
MnSOD tggacaaacctgagccctaa gacccaaagtcacgcttgata
NRF1 atagtcctgtctggggaaacc tccatgcatgaactccatct
NRF2 agcatgatggacttggaattg cctccaaaggatgtcaatcaa
PRX3 agaagaacctgcttgacagaca caggggtgtggaatgaaga
PRX5 gactatggccccgatcaa aaaacacctttcttgtccttgaa
TXN2 cacacagaccttgccattga acgtccccgttcttgatg
TXNRD2 gcacatggtgaagctacctaga gctccatccacatcttctcag